View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11603_high_25 (Length: 275)
Name: NF11603_high_25
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11603_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 265
Target Start/End: Complemental strand, 32376776 - 32376527
Alignment:
| Q |
16 |
caatgctaacatgtgcaaacgccgagaaagcgttgaatcatgattttcgtctttagatgtagattcaaaagctctctggtggatgcacacgtgtagcgcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32376776 |
caatgctaacatgtgcaaacgccgagaaagcgttgaatcatgattttcgtctttagatgtagattcaaaagctctctggtggatgcacatgtgtagcgcc |
32376677 |
T |
 |
| Q |
116 |
gccgaggattcaattattataatgttgggactatgctggatattgatcaacccaattaaagtgtgtaaattctttagaagaaaatgctaaatcttatgct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376676 |
gccgaggattcaattattataatgttgggactatgctggatattgatcaacccaattaaagtgtgtaaattctttagaagaaaatgctaaatcttatgct |
32376577 |
T |
 |
| Q |
216 |
acaggttttggcagggataatgcaccataaagcttcagtattactctctg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376576 |
acaggttttggcagggataatgcaccataaagcttcagtattactctctg |
32376527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University