View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11603_high_27 (Length: 260)
Name: NF11603_high_27
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11603_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 4 - 249
Target Start/End: Original strand, 47350088 - 47350330
Alignment:
| Q |
4 |
taagacgtgacaatgatacatttaatggaccatgacccgtatgtctagtaaaaataatatttagtatatggttttttgctaggatattattatatgaatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47350088 |
taagacgtgacaatgatacatttaatggaccatgacccgtatgtctagtaaaaataatatttagtatatggttttttgctaggatatt---atatgaatg |
47350184 |
T |
 |
| Q |
104 |
aatatgtgcattgaatgtgcagtgaacacattgatgggtaaacgggtacattctgcagcttcagcactgtaaataaatccttttatgtgatgaaaacagc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350185 |
aatatgtgcattgaatgtgcagtgaacacattgatgggtaaacgggtacattctgcagcttcagcactgtaaataaatccttttatgtgatgaaaacagc |
47350284 |
T |
 |
| Q |
204 |
ctttgaagcaatactgacgctgtatgggccttccccactccttcat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350285 |
ctttgaagcaatactgacgctgtatgggccttccccactccttcat |
47350330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University