View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11603_low_27 (Length: 268)
Name: NF11603_low_27
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11603_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 27 - 247
Target Start/End: Complemental strand, 7632029 - 7631809
Alignment:
| Q |
27 |
aaggcaagtggataaaaacttgcataattaatctttttatttagcaaaatcaatcgtcttaaacacaacttccaatttccatagacctagaatttaatac |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7632029 |
aaggcaagtggataaaaacttgcataattagtctttttatttaacaaaatcaatcgtcttaaacacaacttccaatttccatagacctagaatttaatac |
7631930 |
T |
 |
| Q |
127 |
tttttagcaaaccgattcctcatcccaataacaaacctcatccttctatatatgcatgtaggacgcgtgatgttgcataactagtagcttttcgaaagga |
226 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7631929 |
tatttagcaaaccgattcctcatcccaataacaaacctcatccttctatatatgcatgtacgacgcgtgatgttgcataactagtagcttttcgaaagga |
7631830 |
T |
 |
| Q |
227 |
agataaacaacaccaagcatc |
247 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7631829 |
agataaacaacaccaagcatc |
7631809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University