View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11603_low_31 (Length: 218)
Name: NF11603_low_31
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11603_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 12 - 208
Target Start/End: Original strand, 32822899 - 32823092
Alignment:
| Q |
12 |
agaagattcacaagaacacccttcctttagctgtcactgaggagcttgttgcagccgcaaacagcgatgagagtgagagggagaacaagaagaagaagta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32822899 |
agaagattcacaagaacacccttcctttaactgtcactgaggagcttgttgcagcggaaaacagcgatgagagtgagagggggaa---gaagaagaagta |
32822995 |
T |
|
| Q |
112 |
ctctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaatagaatctacgccgcacttcaatcttcctttgct |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822996 |
ctctcgagaggtgatggaagctacgaggtttgtgaatgtccccgagcagtgcaaattctggaatagaatctacgccgcacttcaatcttcctttgct |
32823092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 101 - 208
Target Start/End: Original strand, 52721673 - 52721780
Alignment:
| Q |
101 |
aagaagaagtactctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaatagaatctacgccgcacttcaatctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||| | ||||| ||| |||||||| | ||||||| |||| ||||||||| |
|
|
| T |
52721673 |
aagaagaagtactctcgagagatgatggagtctatgaggtttgtgaatgtctctcagcagctcaaattctggaaaacaatctacaccgcgcttcaatctg |
52721772 |
T |
|
| Q |
201 |
cctttgct |
208 |
Q |
| |
|
| |||||| |
|
|
| T |
52721773 |
cttttgct |
52721780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University