View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11603_low_31 (Length: 218)

Name: NF11603_low_31
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11603_low_31
NF11603_low_31
[»] chr6 (1 HSPs)
chr6 (12-208)||(32822899-32823092)
[»] chr1 (1 HSPs)
chr1 (101-208)||(52721673-52721780)


Alignment Details
Target: chr6 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 12 - 208
Target Start/End: Original strand, 32822899 - 32823092
Alignment:
12 agaagattcacaagaacacccttcctttagctgtcactgaggagcttgttgcagccgcaaacagcgatgagagtgagagggagaacaagaagaagaagta 111  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||| |||   ||||||||||||    
32822899 agaagattcacaagaacacccttcctttaactgtcactgaggagcttgttgcagcggaaaacagcgatgagagtgagagggggaa---gaagaagaagta 32822995  T
112 ctctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaatagaatctacgccgcacttcaatcttcctttgct 208  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
32822996 ctctcgagaggtgatggaagctacgaggtttgtgaatgtccccgagcagtgcaaattctggaatagaatctacgccgcacttcaatcttcctttgct 32823092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 101 - 208
Target Start/End: Original strand, 52721673 - 52721780
Alignment:
101 aagaagaagtactctcgagagatgatggaagctacgaggtttgtgaatgtccccgagcagtgcaagttctggaatagaatctacgccgcacttcaatctt 200  Q
    |||||||||||||||||||||||||||||  ||| |||||||||||||||| |  |||||  ||| |||||||| | ||||||| |||| |||||||||     
52721673 aagaagaagtactctcgagagatgatggagtctatgaggtttgtgaatgtctctcagcagctcaaattctggaaaacaatctacaccgcgcttcaatctg 52721772  T
201 cctttgct 208  Q
    | ||||||    
52721773 cttttgct 52721780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University