View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11603_low_34 (Length: 208)

Name: NF11603_low_34
Description: NF11603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11603_low_34
NF11603_low_34
[»] chr2 (1 HSPs)
chr2 (16-190)||(37727858-37728032)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 190
Target Start/End: Original strand, 37727858 - 37728032
Alignment:
16 aggcatatgatgcacatgaacccccaacccaaaagaaagaaaatcgattatgcaatgcttaacttcctacttcatacaacacttgtcatatatatggata 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37727858 aggcatatgatgcacatgaacccccaacccaaaagaaagaaaatcgattatgcaatgcttaacttcctacttcatacaacacttgtcatatatatggata 37727957  T
116 tacataatgcttaatcttttggatggcctttgggaagatagataatgcatcagacattgaacgattatagggatt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
37727958 tacataatgcttaatcttttggatggcctttgggaagatagataatgcatcagacattgaacgattattgggatt 37728032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University