View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11604_low_5 (Length: 262)
Name: NF11604_low_5
Description: NF11604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11604_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 42719535 - 42719768
Alignment:
| Q |
20 |
cccttgtgaaaaatcttcaggcagaatcccaacagtagaaaattgattcctcatttctgatttcaaa-tggcctaaattctccatttaggcactgtgatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42719535 |
cccttgtgaaaaatcttcaggcagaatcccaacagtagaaaattgattcctcatttctgatttcaaaatggcctaaattctccatttaggcactgtgatg |
42719634 |
T |
 |
| Q |
119 |
atgtcacctatcttttgtaagtgggtcctacaatacctttctctccataccaccttaccctctgctgcttacttctgctctctttggtgcagtctctttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42719635 |
atgtcacctatcttttgtaagtgggtcctacaatacctttctctccataccaccttaccctctgctgcttacttctgctctctttggtgcagtctctttg |
42719734 |
T |
 |
| Q |
219 |
ctttccccatcactactcaccgtacctgcctttg |
252 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
42719735 |
cttgccccatcactactcaccgtacctgcctttg |
42719768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University