View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11604_low_7 (Length: 230)

Name: NF11604_low_7
Description: NF11604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11604_low_7
NF11604_low_7
[»] chr1 (1 HSPs)
chr1 (9-215)||(44990881-44991087)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 215
Target Start/End: Complemental strand, 44991087 - 44990881
Alignment:
9 aggagcagcacagaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggaagtacacgaa 108  Q
    ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
44991087 aggagcaacactgaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggtagtacacgaa 44990988  T
109 ccaagtctccggtgacacatccaaccacttcaatttctggtcaacccaacagttcaatttcttcttgctcttctttagcaccaaactcttttgctgaaga 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
44990987 ccaagtctccggtgacacatccaaccacttcaatttctggtcaacccaacagctcaatttcttcttgctcttctttagcaccaaactcttttgctgaaga 44990888  T
209 agaagaa 215  Q
    |||||||    
44990887 agaagaa 44990881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University