View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11605_low_16 (Length: 202)
Name: NF11605_low_16
Description: NF11605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11605_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 56330162 - 56330352
Alignment:
| Q |
1 |
cgcgactattattttt---catttttacttaatcattcttattcttcttctctttcagacgttgaaaagttttaccagctctgcgatcccggttagt--- |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56330162 |
cgcgactattatttttaaacatttttacttaatcatccttattcttcttctctttcagacgttgaaaagttttaccagctctgcgatcccggttagttct |
56330261 |
T |
|
| Q |
95 |
-tctctctctccttttcttcaccgtgtgtctgcgcgctttttataattctacaattcagtacccgttattttctgctatgctcttactccta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56330262 |
ctctctctctccttttcttcaccgtgtgtctgcgcgc-tttcataattctacaattcagtacccgttattttctgctatgctcttactccta |
56330352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University