View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11605_low_16 (Length: 202)

Name: NF11605_low_16
Description: NF11605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11605_low_16
NF11605_low_16
[»] chr4 (1 HSPs)
chr4 (1-185)||(56330162-56330352)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 56330162 - 56330352
Alignment:
1 cgcgactattattttt---catttttacttaatcattcttattcttcttctctttcagacgttgaaaagttttaccagctctgcgatcccggttagt--- 94  Q
    ||||||||||||||||   ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
56330162 cgcgactattatttttaaacatttttacttaatcatccttattcttcttctctttcagacgttgaaaagttttaccagctctgcgatcccggttagttct 56330261  T
95 -tctctctctccttttcttcaccgtgtgtctgcgcgctttttataattctacaattcagtacccgttattttctgctatgctcttactccta 185  Q
     |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
56330262 ctctctctctccttttcttcaccgtgtgtctgcgcgc-tttcataattctacaattcagtacccgttattttctgctatgctcttactccta 56330352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University