View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11605_low_8 (Length: 342)
Name: NF11605_low_8
Description: NF11605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11605_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 20 - 337
Target Start/End: Complemental strand, 1323833 - 1323527
Alignment:
| Q |
20 |
cctagctgagctgtaatttgcgcaaccttttcagctgctgtggctttcaattcagtcttctccctatatttgaaagattataagataagataagatattg |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1323833 |
cctagctgagctgtaatttgctcaaccttttcagctgctgtggctttcaattcagtcttctccctatatttgaaagattataagataagataagatattg |
1323734 |
T |
|
| Q |
120 |
cgtatatgagactttagaaataattattgttaaagttaggttattttaatgatttgacaattatgaacgactgacggtgtaaaaaatatttacgttaacg |
219 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||| | |
|
|
| T |
1323733 |
cgtatatgagattttagaaataattatcgttgaagttaggttattttaatgatctgataattatgaacgattgacggtgtaaaaaata-----------g |
1323645 |
T |
|
| Q |
220 |
atgaatgaattaatattgtttatataattctaataggagaaggtgtttgagatttacctcaacaatttttggagttcttcaatagcttcatcatagccct |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1323644 |
atgaatgaattaatattgtgtatataattctaataggagaagttgtttgagatttacctcaacaatttttggagttcttcaatagcttcatcatagccct |
1323545 |
T |
|
| Q |
320 |
ttcccatttcttctctct |
337 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1323544 |
ttcccatttcttctctct |
1323527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University