View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11606_low_3 (Length: 405)
Name: NF11606_low_3
Description: NF11606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11606_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 45 - 394
Target Start/End: Complemental strand, 22276439 - 22276094
Alignment:
| Q |
45 |
aattaattaattaacctgaagaggttgagtgagcgaggggtggtgaaagaggtgccggaaatttgttcggcgtagagaccgaaagggcatatgagggggc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22276439 |
aattaattaattaacctgaagaggttgagtgagcgaggggtggtgaaagaggtgccggaaatttgttcggcgtagagaccgaaagggcatatgagggggc |
22276340 |
T |
|
| Q |
145 |
tgttttgtccaactggaagagctccggtgatggcttcggaggagaagtggttgccgaagccagattggtagttgaaatcgtcgccggagatcgagttatc |
244 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22276339 |
tgttttgttcaactggaagagctccggtgatggcttcggaggagaagtggttgccgaagccggattggtagttgaaatcgtcgccggagatcgagttatc |
22276240 |
T |
|
| Q |
245 |
catgtttcaagggattagtagatagagaaagatgctgtctgtcacaaagtatttcggaattgttgttaattcaaacactcgtaatcaatttcaatttgaa |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22276239 |
catgtttcaagggattagtagatagagaaagatgc----tgtcacaaagtgtttcggaattgttgttaattcaaacactcgtaatcaatttcaatttgaa |
22276144 |
T |
|
| Q |
345 |
atgaattggtgtttcatgaaagggacaaagtttgttctgttctctgcttc |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22276143 |
atgaattggtgtttcatgaaagggacaaagtttgttctgttctgtgcttc |
22276094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University