View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11607_high_3 (Length: 332)
Name: NF11607_high_3
Description: NF11607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11607_high_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 332
Target Start/End: Original strand, 3088167 - 3088487
Alignment:
| Q |
11 |
cataggggactgccatgaggatatgtgtgttgcaggagctatcaaaaatttcacttctcaactttctcattacaaagagggaacatctgatcgtagatgt |
110 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088167 |
cataggggactgccttgaggacatgtgtgttgcaggagctatcaaaaatttcacttctcaactttctcattacaaagagggaacatctgatcgtagatgt |
3088266 |
T |
 |
| Q |
111 |
aaggaactcatgtctgtcatttattttccctttcagaaatttttagacttattttacttcatgatattaattactggagattttgttnnnnnnnnnnnnn |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088267 |
aaggaactcatgtctgtcattttttttccctttcagaaatttttagacttattttacttcatgatattaattactggagattttgtt-aaaaaaaaaaaa |
3088365 |
T |
 |
| Q |
211 |
taccattaactggagatattgcagataatatgaccgaggcattattgttcttgtcacacttcatgggagatattcaccaggtttgtctaaagatttttaa |
310 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088366 |
tactattaactggagatattgcagataatatgaccgaggcattattgttcttgtcacacttcatgggagatattcaccaggtttgtctaaagatttttaa |
3088465 |
T |
 |
| Q |
311 |
aatttcttttatcatattactc |
332 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3088466 |
aatttcttttatcatattactc |
3088487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University