View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11607_high_5 (Length: 235)
Name: NF11607_high_5
Description: NF11607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11607_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 30929292 - 30929431
Alignment:
| Q |
1 |
aaataattgacctaaacaagtaaaatcattctccctctttcttccccttactttctctttctaaaaatcacatttcctttcccttctgctttataaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30929292 |
aaataattgacctaaacaagtaaaatcattctccctctctcttccccttactttctctttctaaaaatcacatttcctttcccttctgctttatcaatta |
30929391 |
T |
 |
| Q |
101 |
tgtagtttctcattgttttgagttaatttgtttatggttt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30929392 |
tgtagtttctcattgttttgagttaatttgtttatggttt |
30929431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 30929699 - 30929740
Alignment:
| Q |
176 |
cataacaacactcatatagattcgcaaaaggatatctttcct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30929699 |
cataacaacactcatatagattcgcaaaaggatatctttcct |
30929740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 87 - 153
Target Start/End: Original strand, 30931779 - 30931845
Alignment:
| Q |
87 |
tgctttataaattatgtagtttctcattgttttgagttaatttgtttatggtttgctctatgtagtg |
153 |
Q |
| |
|
|||||||| || | |||||||||||||| ||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
30931779 |
tgctttatcaactttgtagtttctcattatttagatttaatttgtttatgatttgctctatgtagtg |
30931845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University