View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1160_high_6 (Length: 267)
Name: NF1160_high_6
Description: NF1160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1160_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 46 - 242
Target Start/End: Complemental strand, 38849984 - 38849788
Alignment:
| Q |
46 |
gttggatatcactactgtcactgtttctttgtacctgcatcttgtgagagattgacactaacaagggttacttaatcaactttttagtgtgcgtaacttt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38849984 |
gttggatatcactactgtcactgtttctttgtacctgcatcttgtgagagattgacactaacaagggttacttaatcaactttttagtgtgcgtaacttt |
38849885 |
T |
 |
| Q |
146 |
agatattaatcaactgtttgtttctttgtacctgctgcatctttgcaaatattgtttatgtctcttttcttcttctttagcactccttgtcctatga |
242 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38849884 |
agattttaatcaactgtttgtttctttgtacctgctgcatctttgcaaatattgtttatgactcttttcttcttctttagcactcctcgtcctatga |
38849788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University