View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1160_high_8 (Length: 256)
Name: NF1160_high_8
Description: NF1160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1160_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 26 - 221
Target Start/End: Original strand, 7158309 - 7158504
Alignment:
| Q |
26 |
acacagtgcctccacatggacatcaacaaggtggggcagcaggtggctttgttctcccaacaataaagaattgttttaactcccttgaatcgaagatgaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7158309 |
acacagtgcctccacatggacatcaacaaggtggggcagcaggtggctttgttctcccaacaataaagaattgttttaactcccttgaatcgaagatgaa |
7158408 |
T |
 |
| Q |
126 |
gcaggggaaggtattgaaaccaaatcagaatgtgctgatgttgacacaaccaggattctcagagaccctcactttggatgccaaatccatattgca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7158409 |
gcaggggaaggtattgaaaccaaatcagaatgtgctgatgttgacacaaccaggcttctcagagaccctcactttggatgccaaatccatattgca |
7158504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University