View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1160_low_10 (Length: 268)
Name: NF1160_low_10
Description: NF1160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1160_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 111 - 227
Target Start/End: Complemental strand, 40239309 - 40239193
Alignment:
| Q |
111 |
atacgggcatgacttgagcaacattagtaggcgaagaatagtactatattctgatgatcaaatggatgctgtttttatttgttgcacaccaaattagtat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
40239309 |
atacgggcatgacttgagcaacattagtaggcgaagaaaagtactatattctgatgatcaaatgcatgctgcttttatttgttgcacaccaaattagtat |
40239210 |
T |
|
| Q |
211 |
agtatatgtcaacccac |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40239209 |
agtatatgtcaacccac |
40239193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 21 - 111
Target Start/End: Complemental strand, 40241872 - 40241782
Alignment:
| Q |
21 |
tcttgacattatactcctaaatgcattggtcagcatgtgtgtaaccactacgtgtgaaaatgcatacttggctgatttaatgcatgaagta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
40241872 |
tcttgacattatactcctaaatgcattggtcagcatgtgtgtaaccactacgtgtgaaaatgcatacctagctgatttaatgcatgaagta |
40241782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University