View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1160_low_19 (Length: 207)
Name: NF1160_low_19
Description: NF1160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1160_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 53 - 91
Target Start/End: Complemental strand, 3666138 - 3666100
Alignment:
| Q |
53 |
tatgggtattattttctgaaacagaaatgaaataatatt |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3666138 |
tatgggtattattttctgaaacagaaatgaaataatatt |
3666100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University