View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11610_high_11 (Length: 235)
Name: NF11610_high_11
Description: NF11610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11610_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 35977061 - 35977266
Alignment:
| Q |
18 |
ggttttggtgatatatttggtgaaggggtatgagggaaccatatggatggagatgttgacacgtgtatgggttttaatggtgggattataaggggatttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35977061 |
ggttttggtgatatatttggtgaaggggtatgagggaaccatatggatggagatgttgacacgtgtatgggttttaatggttggattataaggggatttg |
35977160 |
T |
|
| Q |
118 |
tcgggaaaatgaggtcatggatgatgtaataataagaatgattgtggtttttgtagtggacatactagtttggttctgcccctacttgcctgccttttcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35977161 |
tcgggaaaatgaggtcatggatgatgtaataataagaatgattgtggtttttgtagtggacatactagtttggtcctgcccctacttgcctgccttttcc |
35977260 |
T |
|
| Q |
218 |
tttgct |
223 |
Q |
| |
|
|||||| |
|
|
| T |
35977261 |
tttgct |
35977266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University