View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11610_high_6 (Length: 295)
Name: NF11610_high_6
Description: NF11610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11610_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 22 - 285
Target Start/End: Original strand, 24834056 - 24834320
Alignment:
| Q |
22 |
ctgggttggtccattcattggtgcagcattggcagcacttatatatgaatatcttgtgatcccaactgagccacctcatgcacaccaacctcttgctcct |
121 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24834056 |
ctgggttggtccattcatcggtgcagcattggcagcactcatatatgaatatcttgtgatcccaactgagccacctcatgcacaccagcctcttgctcct |
24834155 |
T |
 |
| Q |
122 |
gaagattactagttacctacttctgtttatcattgtgtgtttgtcattagtgtcttgtttgttgtatcatttcgtttttacgac-nnnnnnnngtttagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24834156 |
gaagattactagttacctacttctgtttatcattgtgtgtttgtcattagtgtcttgtttgttgtatcatttcgtttttacgacttttttttggtttagt |
24834255 |
T |
 |
| Q |
221 |
ttcaattgagccaatatgctgtatttttctactgttcttggggtctcagcttatgtgtatctgtg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24834256 |
ttcaattgagccaatatgctgtatttttctactgttcttggggtctcagcttatgtgtatctgtg |
24834320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University