View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11610_low_16 (Length: 218)
Name: NF11610_low_16
Description: NF11610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11610_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 393768 - 393982
Alignment:
| Q |
1 |
cactcgtttaaatgagctccagagctactgccgcgacgaaatcctttattccaagccacttgaagtattgtcaaaatcccccaatg----gc-----aaa |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
393768 |
cactcgtttaaatgagctccagatctactgccgtgacgaaatcctttattccaagccacttgaagtattgtcaaaatcccccaatgctttgccattaaaa |
393867 |
T |
 |
| Q |
92 |
------aggcgcccaaatttcaagagaatacggttcgccagctacccgaatcatcacgaattacttcaccacacacaacttaattatccttaagcattaa |
185 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
393868 |
tcaagcaggcgcccaaatttcgagagaatccggttcgccagctacccgaatcattacgaattacttcaccacacacaacttaattatccttaagcattaa |
393967 |
T |
 |
| Q |
186 |
agctccatctgtatt |
200 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
393968 |
agctctatctgtatt |
393982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University