View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11612_high_10 (Length: 288)

Name: NF11612_high_10
Description: NF11612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11612_high_10
NF11612_high_10
[»] scaffold0112 (3 HSPs)
scaffold0112 (24-280)||(25658-25917)
scaffold0112 (96-158)||(40835-40897)
scaffold0112 (24-135)||(40943-41060)
[»] scaffold0416 (1 HSPs)
scaffold0416 (24-158)||(7294-7434)
[»] chr5 (3 HSPs)
chr5 (24-158)||(26792194-26792334)
chr5 (112-162)||(26834867-26834917)
chr5 (105-161)||(26745798-26745854)
[»] scaffold0759 (1 HSPs)
scaffold0759 (67-158)||(2407-2501)
[»] chr3 (3 HSPs)
chr3 (98-163)||(12110383-12110448)
chr3 (98-163)||(12124071-12124136)
chr3 (98-163)||(12128218-12128283)
[»] scaffold0093 (1 HSPs)
scaffold0093 (112-163)||(21213-21264)
[»] chr8 (1 HSPs)
chr8 (236-281)||(32061723-32061768)


Alignment Details
Target: scaffold0112 (Bit Score: 170; Significance: 3e-91; HSPs: 3)
Name: scaffold0112
Description:

Target: scaffold0112; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 24 - 280
Target Start/End: Complemental strand, 25917 - 25658
Alignment:
24 tccatgcggcaactccataacgtgtcgttgtgtccatttggat---tttggaatgacctgcattgatacgggcgctggcctctaactctaatgaaaagga 120  Q
    ||||||||||||||||||||||||||  ||||||  |||| |    |||||||||||||||||||        | |||||||||||||||||||||||||    
25917 tccatgcggcaactccataacgtgtcaatgtgtcagtttgcaaatatttggaatgacctgcattggagtaccagatggcctctaactctaatgaaaagga 25818  T
121 gtacttgaagatggctttggatattgccacttaagaatgatattgccaccaaaaccgtaaacatggatatctaaccgtttccggaccatatggttttaaa 220  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||    
25817 gtacttgaagatggctttggatattgctacttaagaatgatattgccgccaaaaccgtaaacatggatatctagccgtttccggaccatatgattttaaa 25718  T
221 tgatatgttacttctccctctcttttttgtgagccttcagctaaaaccccaatttcttct 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25717 tgatatgttacttctccctctcttttttgtgagccttcagctaaaaccccaatttcttct 25658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0112; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 96 - 158
Target Start/End: Complemental strand, 40897 - 40835
Alignment:
96 tggcctctaactctaatgaaaaggagtacttgaagatggctttggatattgccacttaagaat 158  Q
    |||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||    
40897 tggcctctaactctaatgaaaaagactacttgaagatggctttggaaattgccacttaagaat 40835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0112; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 135
Target Start/End: Complemental strand, 41060 - 40943
Alignment:
24 tccatgcggcaactccataacgtgtcgttgtgtccatttggattt---tggaatgacctgcattga---tacgggcgctggcctctaactctaatgaaaa 117  Q
    |||||||||| ||  || |||||||||||||||| ||||| ||||   |||||  |||||| ||||   || ||| | |||||||||| ||||||||||     
41060 tccatgcggcgacatcacaacgtgtcgttgtgtctatttgcatttagttggaagtacctgcgttgactataggggtgatggcctctaattctaatgaaat 40961  T
118 ggagtacttgaagatggc 135  Q
    ||||||||||||||||||    
40960 ggagtacttgaagatggc 40943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0416 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0416
Description:

Target: scaffold0416; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 24 - 158
Target Start/End: Complemental strand, 7434 - 7294
Alignment:
24 tccatgcggcaactccataacgtgtcgttgtgtccatttggattt---tggaatgacctgcattga---tacgggcgctggcctctaactctaatgaaaa 117  Q
    |||||||||| ||  | ||||||||||||||||||||||| ||||   |||||  |||||||||||   |||||| | ||||||||||||||||||||||    
7434 tccatgcggcgacatcgtaacgtgtcgttgtgtccatttgcatttagttggaagtacctgcattgactatacgggtgatggcctctaactctaatgaaaa 7335  T
118 ggagtacttgaagatggctttggatattgccacttaagaat 158  Q
     || |||||||||||||||||||| ||||||||||||||||    
7334 agactacttgaagatggctttggaaattgccacttaagaat 7294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 8e-24; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 24 - 158
Target Start/End: Original strand, 26792194 - 26792334
Alignment:
24 tccatgcggcaactccataacgtgtcgttgtgtccatttggat---tttggaatgacctgcattga---tacgggcgctggcctctaactctaatgaaaa 117  Q
    |||||||||||| |||||||||||||  ||||||  |||| |    ||||||||| ||||||||||   |||||| | ||||||||||||||||||||||    
26792194 tccatgcggcaattccataacgtgtcagtgtgtcagtttgtacatatttggaatgtcctgcattgactatacgggtgatggcctctaactctaatgaaaa 26792293  T
118 ggagtacttgaagatggctttggatattgccacttaagaat 158  Q
      | |||||||||||||||||||| ||||||||||||||||    
26792294 aaactacttgaagatggctttggaaattgccacttaagaat 26792334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 162
Target Start/End: Original strand, 26834867 - 26834917
Alignment:
112 tgaaaaggagtacttgaagatggctttggatattgccacttaagaatgata 162  Q
    |||||| || || |||| |||||||||||| ||||||||||||||||||||    
26834867 tgaaaatgactaattgaggatggctttggaaattgccacttaagaatgata 26834917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 105 - 161
Target Start/End: Original strand, 26745798 - 26745854
Alignment:
105 actctaatgaaaaggagtacttgaagatggctttggatattgccacttaagaatgat 161  Q
    |||||| |||||| || |||||||||| | ||||||| |||||||||||| ||||||    
26745798 actctattgaaaaagactacttgaagacgactttggaaattgccacttaaaaatgat 26745854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0759 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0759
Description:

Target: scaffold0759; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 67 - 158
Target Start/End: Original strand, 2407 - 2501
Alignment:
67 tttggaatgacctgcattga---tacgggcgctggcctctaactctaatgaaaaggagtacttgaagatggctttggatattgccacttaagaat 158  Q
    |||||||||| |||||||||   |||||| | ||||||||||||||||||||||  | |||||||||||||||||||| ||||||||||||||||    
2407 tttggaatgatctgcattgactatacgggtgatggcctctaactctaatgaaaaaaactacttgaagatggctttggaaattgccacttaagaat 2501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 98 - 163
Target Start/End: Original strand, 12110383 - 12110448
Alignment:
98 gcctctaactctaatgaaaaggagtacttgaagatggctttggatattgccacttaagaatgatat 163  Q
    |||||||| ||||| ||| | || ||| | |||||||||||||| |||||||||||||||||||||    
12110383 gcctctaaatctaaagaacaagactaccttaagatggctttggaaattgccacttaagaatgatat 12110448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 98 - 163
Target Start/End: Original strand, 12124071 - 12124136
Alignment:
98 gcctctaactctaatgaaaaggagtacttgaagatggctttggatattgccacttaagaatgatat 163  Q
    ||||||||||| || ||||| |  ||| | |||||||||||||| |||||||||||||||||||||    
12124071 gcctctaactccaaagaaaaaggctaccttaagatggctttggaaattgccacttaagaatgatat 12124136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 163
Target Start/End: Original strand, 12128218 - 12128283
Alignment:
98 gcctctaactctaatgaaaaggagtacttgaagatggctttggatattgccacttaagaatgatat 163  Q
    |||||||| ||||| ||| | || ||| | |||||||||||||| ||||| |||||||||||||||    
12128218 gcctctaaatctaaagaacaagactaccttaagatggctttggaaattgcaacttaagaatgatat 12128283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0093 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0093
Description:

Target: scaffold0093; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 112 - 163
Target Start/End: Original strand, 21213 - 21264
Alignment:
112 tgaaaaggagtacttgaagatggctttggatattgccacttaagaatgatat 163  Q
    |||||| || ||||||| |||||||||||| |||||||||||||||| ||||    
21213 tgaaaaagactacttgaggatggctttggaaattgccacttaagaattatat 21264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 281
Target Start/End: Original strand, 32061723 - 32061768
Alignment:
236 ccctctcttttttgtgagccttcagctaaaaccccaatttcttctc 281  Q
    |||||||| ||||||||||| |||||| |||||| |||||||||||    
32061723 ccctctctcttttgtgagccgtcagctgaaaccctaatttcttctc 32061768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University