View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11612_high_5 (Length: 439)
Name: NF11612_high_5
Description: NF11612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11612_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 224 - 429
Target Start/End: Complemental strand, 22201704 - 22201498
Alignment:
| Q |
224 |
caagggaacagttagctactatacatttatgttaaagtggtgagctttcttcctgctgttccctagttatgtaggcttcaatatgaaaaatatgatgtgt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22201704 |
caagggaacagttagctactatacatttatgttaaagtggtgagctttcttcctgctgttccctagttatgtaggcttcaatatgaaaaatatgatatgt |
22201605 |
T |
 |
| Q |
324 |
ctctctcaactcaaccatctagaatctagctttgtccagtgctatgagtactttgctggattgagattt-aaatgtagtggaccattagtttaattcttc |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
22201604 |
ctctctcaactcaaccatctagaatctagctttgtccagtgctataagtactttgctggattgagatttaaaatgtagtggaccattagtttaattctcc |
22201505 |
T |
 |
| Q |
423 |
ccctatg |
429 |
Q |
| |
|
||||||| |
|
|
| T |
22201504 |
ccctatg |
22201498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 27 - 164
Target Start/End: Complemental strand, 22202604 - 22202467
Alignment:
| Q |
27 |
gtgtggcatattaatttagtgaccatgttttctgtctctaaaaaatatttcttctttcactaatctcctacagtgaggtaaatataatttcctcttggac |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22202604 |
gtgtggcatattaatttagtgaccatgttttctgtctctaaaaaatagttcttctttcactaatctcctagagtgtggtaaatataatttcctcttggac |
22202505 |
T |
 |
| Q |
127 |
caagcataatccccttatgttaaattttttcttataac |
164 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22202504 |
caagcataatccccttatcttaaattttttcttataac |
22202467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University