View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11612_low_12 (Length: 281)
Name: NF11612_low_12
Description: NF11612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11612_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 157 - 268
Target Start/End: Original strand, 30059061 - 30059172
Alignment:
| Q |
157 |
tttgtcggtatgcccttagtcaatgcatttttcaattaatgtcttgaaggagcattagatgtggttatcaataaactcgttaattaactatttggtttct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30059061 |
tttgtcggtatgcccttagtcaatgcatttttcaattaatgtcttgaaggagcattagatgtggttatcaataaactccttaattaactatttggtttct |
30059160 |
T |
|
| Q |
257 |
ctttcgtgatgt |
268 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30059161 |
ctttcgtgatgt |
30059172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 30058919 - 30058955
Alignment:
| Q |
117 |
accaatattttcaatgttggatggcctaaaattttaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30058919 |
accaatattttcaatgttggatggcctaaaattttaa |
30058955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 38 - 70
Target Start/End: Original strand, 30058847 - 30058879
Alignment:
| Q |
38 |
ggtgtggttgtcgggtgataagtgatgtcccgt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30058847 |
ggtgtggttgtcgggtgataagtgatgtcccgt |
30058879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University