View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11612_low_8 (Length: 376)
Name: NF11612_low_8
Description: NF11612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11612_low_8 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 376
Target Start/End: Complemental strand, 45652543 - 45652149
Alignment:
| Q |
17 |
aaggatatggtcatttgtttagagactatgaatcattgaaatgcatgcatgattatgcatctgatggtaaaattatggcgttaaatattgttgt----gg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
45652543 |
aaggatatggtcatttgtttagagactatgaatcattgaaatgcatgcatgattatgcctctgatggtaaaattatggtgttaaatattgttgtggccgg |
45652444 |
T |
|
| Q |
113 |
tagtagtgtaaaattgtggtcttcaatacttgtatcatatgtctttaacaatgttgaaagcttctttctcttg----------------aaccttttaag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45652443 |
tagtagtgtaaaattgtggtcttcaatacttgtatcatatgtctttaacaatgttgaaagcttctttctcttgaattcaaatatgctcaaaccttttaag |
45652344 |
T |
|
| Q |
197 |
tttgctttgcctttta--tgtgtaaatggcagtcattagtattccaaaattctataagattgggactatgaagtgtatctagtaagatcagtctaacaac |
294 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652343 |
tttgctttgccttttatttgtgtaaatggcagtcattagtactccaaaattctataagattgggactatgaagtgtatctagtaagatcagtctaacaac |
45652244 |
T |
|
| Q |
295 |
ttaggattagaacaaaacctatttaatctttcattga-------------tgtcagcttgatcgcgaatgtgcaaaccaagtcaatatgcctagt |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652243 |
ttaggattagaacaaaacctatttaatctttcattaatatatatgatgattgtcagcttgatcgcgaatgtgcaaaccaagtcaatatgcctagt |
45652149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 69 - 147
Target Start/End: Complemental strand, 31523884 - 31523806
Alignment:
| Q |
69 |
ttatgcatctgatggtaaaattatggcgttaaatattgttgtggtagtagtgtaaaattgtggtcttcaatacttgtat |
147 |
Q |
| |
|
|||||| |||| || ||||||||||| |||||||||||| ||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
31523884 |
ttatgcctctgttgataaaattatggtgttaaatattgtagtgtcagtggtgtaaaattttggtcttcaatacttgtat |
31523806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University