View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11613_high_10 (Length: 307)
Name: NF11613_high_10
Description: NF11613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11613_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 68 - 277
Target Start/End: Complemental strand, 38091367 - 38091158
Alignment:
| Q |
68 |
gcaaaacaatattcaacttttatatgttttaatcaataaatatggatctcatttgagaggattaataaattcaatctgatttctatttgatatacaatta |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38091367 |
gcaaaacaatattcaacttttatatgttttaatcaataaatatggatctcttttgagaggattaataaattcaatctgatttctatttgatatacaatta |
38091268 |
T |
 |
| Q |
168 |
taaataaaattgatgatgtctcttatggatcggattctcccctgcattgnnnnnnnnagttccaagtaagaagtatgtgaaaattcatggtttaagagct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38091267 |
taaataaaattgatgatgtctcttatggatcggattctcccctgcattgttttttttagttccaagtaagaagtatgtgaaaattcatggtttaagagct |
38091168 |
T |
 |
| Q |
268 |
aaattctcta |
277 |
Q |
| |
|
|||||||||| |
|
|
| T |
38091167 |
aaattctcta |
38091158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 38091595 - 38091537
Alignment:
| Q |
18 |
aaacctccataagtataagaaccaaaatgaagaagtggcgacaagtatgagcaaaacaa |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38091595 |
aaacctccataagtataagaaccaaaatgaagaagtggcgacaagtatgagcaaaacaa |
38091537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University