View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11613_high_12 (Length: 274)
Name: NF11613_high_12
Description: NF11613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11613_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 20 - 262
Target Start/End: Original strand, 42158598 - 42158841
Alignment:
| Q |
20 |
tacagcccttaaa-ctctttctcaagtcccctcagttttttcaaggtgcgagaatcgtttgtagcattctcgaacatgagaatctcaagagaatcaagcc |
118 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42158598 |
tacagcccttaaaactttttctcaagtcccctcagttttttcaaggtgcaagaatcgtttgtagcattctcgaacatgagaatcttaagagaatcaagcc |
42158697 |
T |
|
| Q |
119 |
aaggtccacgaaaacgaaatgtatggtgaagatcttcaagtaacttaacgagtagagagcgttgattgtcaaggagatctaagattgaatggtttttgag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42158698 |
aaggtccacgaaaacgaaatgtatggtgaagatcttcaagtaacttaacgagtagaaagcgttgattgtcaaggagatctaagattgaatggttcttgag |
42158797 |
T |
|
| Q |
219 |
aagaagtaaaagttccgccaaggttgtgtatgccaagcccttca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42158798 |
aagaagtaaaagttccgccaaggttgtgtatgccaagcccttca |
42158841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University