View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11613_high_7 (Length: 356)
Name: NF11613_high_7
Description: NF11613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11613_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 351
Target Start/End: Original strand, 10908629 - 10908961
Alignment:
| Q |
19 |
acactatggttaaataagttaatggggccattcaatgtagacatttttctggaattannnnnnnngatgttattgaaccatgtgtttgtagagatgtttt |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10908629 |
acactatggttaaataggttaatggggccattcaatgtagacatttttctggaattaatttttttgatgttattgaaccatgtgtttgtagagatgtttt |
10908728 |
T |
 |
| Q |
119 |
acaattttaaatgttatagaatctagtgagaacttttgtgtatctatcaggattcttcttactgttgtttcacattctttttcaggtccaacttgcaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10908729 |
acaattttaaatgttatagaatctagtgagaacttttgtgtatctatcaggattcttcttactgttgtttcacattctttttcaggtccaacttgcaaat |
10908828 |
T |
 |
| Q |
219 |
ccaaaccaacttgctgatcattatgcctccaaacatccgaaggagaaacctcctgcagagtcaagctagtgatccttggagcaaatagtacaaaagttcc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10908829 |
ccaaaccaacttgctgatcattatgcctccaaacatccgaaggagaaacctcctgcagagtcaagctagtgatccttggagcaaatagtacaaaagttcc |
10908928 |
T |
 |
| Q |
319 |
caaagaaaatttgctcagtgtccctatgcttct |
351 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |
|
|
| T |
10908929 |
caaagaaaatttgctcagtgtctctatgtttct |
10908961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University