View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11613_high_8 (Length: 328)
Name: NF11613_high_8
Description: NF11613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11613_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 37799026 - 37799119
Alignment:
| Q |
19 |
tataatcttctaaataagtaatgtgattaaccttctttccaaaggttttaaataatggtctcagtcacgctaaggttttcgtgatttcgacttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
37799026 |
tataatcttctaaataagtaatgtgattaaccttctttccaaaggttttaaataatggtctcagtcacgctaagattttcgtgatttcaacttt |
37799119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 198 - 286
Target Start/End: Original strand, 37799205 - 37799293
Alignment:
| Q |
198 |
ggtcactcactctaactctatgtctcgatcattattctctgtttttctttttcatcaccaagagagttgcaacacaatcaaaaccctaa |
286 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37799205 |
ggtcattcactctaactctatgtctcgatcattattttctgtttttctttttcatcaccaagagagttgcaacacaatcaaaaccctaa |
37799293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 198 - 255
Target Start/End: Complemental strand, 50607135 - 50607078
Alignment:
| Q |
198 |
ggtcactcactctaactctatgtctcgatcattattctctgtttttctttttcatcac |
255 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| |||| |||||||||||| |
|
|
| T |
50607135 |
ggtcactcactctaactctatgtctctatcatcgttctctattttcctttttcatcac |
50607078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University