View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11613_low_10 (Length: 307)

Name: NF11613_low_10
Description: NF11613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11613_low_10
NF11613_low_10
[»] chr8 (2 HSPs)
chr8 (68-277)||(38091158-38091367)
chr8 (18-76)||(38091537-38091595)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 68 - 277
Target Start/End: Complemental strand, 38091367 - 38091158
Alignment:
68 gcaaaacaatattcaacttttatatgttttaatcaataaatatggatctcatttgagaggattaataaattcaatctgatttctatttgatatacaatta 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
38091367 gcaaaacaatattcaacttttatatgttttaatcaataaatatggatctcttttgagaggattaataaattcaatctgatttctatttgatatacaatta 38091268  T
168 taaataaaattgatgatgtctcttatggatcggattctcccctgcattgnnnnnnnnagttccaagtaagaagtatgtgaaaattcatggtttaagagct 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||    
38091267 taaataaaattgatgatgtctcttatggatcggattctcccctgcattgttttttttagttccaagtaagaagtatgtgaaaattcatggtttaagagct 38091168  T
268 aaattctcta 277  Q
    ||||||||||    
38091167 aaattctcta 38091158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 38091595 - 38091537
Alignment:
18 aaacctccataagtataagaaccaaaatgaagaagtggcgacaagtatgagcaaaacaa 76  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38091595 aaacctccataagtataagaaccaaaatgaagaagtggcgacaagtatgagcaaaacaa 38091537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University