View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11614_high_18 (Length: 444)
Name: NF11614_high_18
Description: NF11614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11614_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 236 - 429
Target Start/End: Original strand, 31700170 - 31700363
Alignment:
| Q |
236 |
cagcgttgtgtccactttactattattatcagacgcatccgattaattaccttcttcttgcggttttcactctctcgctttcttttgttgttggattgag |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31700170 |
cagcgttgtgtccactttactattattatcagacgcatccgattaattaccttcttcttgcggttttcactctctcgctttcttttgttgttggattgag |
31700269 |
T |
|
| Q |
336 |
ctgtgctttcactagcggtaacattcttatcattccatttctgatttctttcttttgatatttattgcttgaattgtaatttaggttgagatga |
429 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31700270 |
ctgtgctttcactagcggtaacattcttttcattccatttctgatttctttcttttgatatttattgcttgaattgtaatttaggttgagatga |
31700363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 17 - 151
Target Start/End: Original strand, 31699953 - 31700087
Alignment:
| Q |
17 |
caactactcgccaccatcgctgtcggtgccgtcgttgtaaccgttcgtcccatttccactttcttcgccaccaccggcgctggtcttgctctttacatcg |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31699953 |
caactactcgccaccatcgccgtcggtgccgtcgttgtaaccgttcgtcccatttccactttctttgccaccaccggcgctggtcttgctctttacatcg |
31700052 |
T |
|
| Q |
117 |
ttctcatcttcgtccctttcatcagtgcgttgccg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31700053 |
ttctcatcttcgtccctttcatcagtgcgttgccg |
31700087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University