View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11614_high_34 (Length: 223)
Name: NF11614_high_34
Description: NF11614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11614_high_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 718531 - 718336
Alignment:
| Q |
18 |
caactaaattaactatggacttgttcaatgtcacttgcttataaatagacattatgtttgcattgtgaaatatatcacccttacataaacatatacaagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
718531 |
caactaaattaactatggacttgttcaatgtcacttgcttataaatagacattatgtttgcattgtgaaatatatcatccttacataaacatatacaagc |
718432 |
T |
 |
| Q |
118 |
aaattacacgaataaaatttctnnnnnnnnncatgaagactacttacttgtttgtgacagccttcttggccttagcatcatgtgcctttgcctttg |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
718431 |
aaattacacgaataaaatttctaaaaaaaaacatgaagactacttacttgtttgtgacagccttcttggccttagcatcatgtgcctttgcctttg |
718336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 703092 - 703043
Alignment:
| Q |
164 |
cttgtttgtgacagccttcttggccttagcatcatgtgcctttgcctttg |
213 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
703092 |
cttgtttgtgacagccttcttagctttagcatcttgtgcctttgcctttg |
703043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 712346 - 712395
Alignment:
| Q |
164 |
cttgtttgtgacagccttcttggccttagcatcatgtgcctttgcctttg |
213 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
712346 |
cttgtttgtgacagccttcttagctttagcatcttgtgcctttgcctttg |
712395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University