View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11614_low_30 (Length: 244)
Name: NF11614_low_30
Description: NF11614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11614_low_30 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 1811820 - 1811601
Alignment:
| Q |
18 |
tacattaatttgtaacttactgccaaggtaaaataaaggtttccactgtcctagtgggactttagaatttgctgcattaggatgtcaagcaaggtaaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1811820 |
tacattaatttgtaacttactgccaaggtaaaataaaggtttccactgtcc-------actttagaatttgatgcattaggatgtcaagcaaggtaaaat |
1811728 |
T |
 |
| Q |
118 |
aaaaattgcacagtcacaaatagaaaggactggagtgatgaccaaccaaaagggcaagaagctagaacttccaccccaacccttatgatcatggttttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1811727 |
aaaaattgcacagtcacaaatagaaaggactggagtgatgaccaaccaaaagggcaagaagctagaacttccaccccaacccttatgatcatggttttaa |
1811628 |
T |
 |
| Q |
218 |
ataaagacatgcggctgcaattgaggc |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1811627 |
ataaagacatgcggctgcaattgaggc |
1811601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University