View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11614_low_32 (Length: 238)
Name: NF11614_low_32
Description: NF11614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11614_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 14924639 - 14924835
Alignment:
| Q |
26 |
tgaggctaataattacatttaatgcactctgacattgnnnnnnncaccctttacatgactttgttcattatgcagactccgtgatttgaagcagctcggt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14924639 |
tgaggctaataattacatttaatgcactctgacattatttttttcaccctttacatgactttgttcattatgcagactccgtgatttgaagcagctcggt |
14924738 |
T |
|
| Q |
126 |
gagtgaacaattaatacttgttgaatagtaataaaatctaataggggaatatatgattggaaaaataactggatatgttgttgttgcatgtttattg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14924739 |
gagtgaacaattaatacttgttgaatagtaataaaatctaataggggaatataggattggaaaaataactggatatgttgttgttgcatgtttattg |
14924835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University