View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11614_low_36 (Length: 208)
Name: NF11614_low_36
Description: NF11614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11614_low_36 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 6516736 - 6516529
Alignment:
| Q |
1 |
ttccttgttttagcacttacgtgacagttttaaatttaattctgcccgtgaaacacgtgttgaaggtgttcctgaacttcttgacgattctgaagtagaa |
100 |
Q |
| |
|
|||||| |||| |||| || ||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
6516736 |
ttcctttttttgtcactaacatgacagttttaaatttaattctgcccgggaaacacgtgttgaaggtgatcctgaacttcttgacgattctgaagtaaaa |
6516637 |
T |
 |
| Q |
101 |
atattatttctgctgattatttttattatataatatttacactgatacatataaatgttttggcatttaggggtcctataggtataatgttgcatgcaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6516636 |
atattatttctgctgattatttttattatataatatttacactgatacatataaatgttttggcatttaggggtcctataggtttaatgttgcatgcaga |
6516537 |
T |
 |
| Q |
201 |
accatctt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
6516536 |
accatctt |
6516529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 94
Target Start/End: Original strand, 27254758 - 27254828
Alignment:
| Q |
24 |
acagttttaaatttaattctgcccgtgaaacacgtgttgaaggtgttcctgaacttcttgacgattctgaa |
94 |
Q |
| |
|
|||||||| ||||||||| ||||| ||||||| || || |||| |||||||||||| |||||||||||| |
|
|
| T |
27254758 |
acagttttgaatttaattgtgcccaggaaacacatgcggacggtgatcctgaacttctggacgattctgaa |
27254828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University