View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11615_high_8 (Length: 254)
Name: NF11615_high_8
Description: NF11615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11615_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 133
Target Start/End: Original strand, 45250040 - 45250161
Alignment:
| Q |
12 |
atgaagcacatgtagattactgagaagagtacaaatccaaaatcttcagggctaaccatgccactggctgataagacaacaacaacagctaaacaattga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45250040 |
atgaagcacatgtagattactgagaagagtacaaatccaaaatcttcagggctaaccatgccactggctgataagacaacaacaacagctaaacaattga |
45250139 |
T |
 |
| Q |
112 |
gttgtcggaatgagaggaaact |
133 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45250140 |
gttgtcggaatgagaggaaact |
45250161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University