View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11615_low_5 (Length: 278)
Name: NF11615_low_5
Description: NF11615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11615_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 15 - 261
Target Start/End: Complemental strand, 44386378 - 44386131
Alignment:
| Q |
15 |
agatattgcacttttttataacaaatattatatatttatttaaatctacgaaatttggtgatgaagctaagcatgtaaatgttgacttgacgcacaagct |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44386378 |
agatattgcacttttt-ataacaaatattatatatttatttaaatctacgcaatttggtgatgaagctaagcatgtaaatgttgacttgacgcacaagct |
44386280 |
T |
|
| Q |
115 |
tcagttaaataaggtgcaacaaaattctactaaatctatatc---cttttttgttttgagggagctaaatctatatgaatatttgaatacnnnnnnnnga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
44386279 |
tcagttaaataaggtgcaacaaaattctactaaatctatatcttttttttttgttttgagggagctaaatctatatgcatatttgaatac-tttttttga |
44386181 |
T |
|
| Q |
212 |
cagcatattcatatgattttggtttctacattcaattgccatttatatgt |
261 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44386180 |
cagcatattcgtatgattttggtttctacattcaattgccatttatatgt |
44386131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University