View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11615_low_6 (Length: 270)

Name: NF11615_low_6
Description: NF11615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11615_low_6
NF11615_low_6
[»] chr8 (2 HSPs)
chr8 (170-270)||(43618621-43618721)
chr8 (1-70)||(43618795-43618864)
[»] chr3 (3 HSPs)
chr3 (215-267)||(5565152-5565205)
chr3 (194-222)||(50834437-50834465)
chr3 (194-222)||(50841388-50841416)
[»] chr7 (1 HSPs)
chr7 (242-270)||(7854246-7854274)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 170 - 270
Target Start/End: Complemental strand, 43618721 - 43618621
Alignment:
170 aggtgacatcattattaatctagaacacaaaaacccttcttcttatgccctcatttcgttcattttttagccttctcccactaaagtaaaagcatcatcg 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||    
43618721 aggtgacatcattattaatctagaacacaaaaacccttcttcttatgccctcatttgcttcattttttagccttctcccactaaagtaaaagcatcatcg 43618622  T
270 t 270  Q
    |    
43618621 t 43618621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 43618864 - 43618795
Alignment:
1 aggtgcatcaacccttaaacaaaaatttcttcattgcaatattgcccccctaaatactagcaattgcgca 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43618864 aggtgcatcaacccttaaacaaaaatttcttcattgcaatattgcccccctaaatactagcaattgcgca 43618795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 215 - 267
Target Start/End: Original strand, 5565152 - 5565205
Alignment:
215 tgccctcatttcgttcatttttt-agccttctcccactaaagtaaaagcatcat 267  Q
    |||||| |||||| ||||||||| ||||||||||||||||||||||||||||||    
5565152 tgcccttatttcgatcattttttcagccttctcccactaaagtaaaagcatcat 5565205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 222
Target Start/End: Original strand, 50834437 - 50834465
Alignment:
194 acacaaaaacccttcttcttatgccctca 222  Q
    |||||||||||||||||||||||||||||    
50834437 acacaaaaacccttcttcttatgccctca 50834465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 222
Target Start/End: Complemental strand, 50841416 - 50841388
Alignment:
194 acacaaaaacccttcttcttatgccctca 222  Q
    |||||||||||||||||||||||||||||    
50841416 acacaaaaacccttcttcttatgccctca 50841388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 270
Target Start/End: Original strand, 7854246 - 7854274
Alignment:
242 ttctcccactaaagtaaaagcatcatcgt 270  Q
    |||||||||||||||||||||||||||||    
7854246 ttctcccactaaagtaaaagcatcatcgt 7854274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University