View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11616_low_4 (Length: 339)
Name: NF11616_low_4
Description: NF11616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11616_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 95 - 329
Target Start/End: Complemental strand, 25729228 - 25728999
Alignment:
| Q |
95 |
ctattagttaaacaaattagaggcctaaatattctttgaggccaaaagcggctactttatttatggnnnnnnnnnnccttctagtaggatagatgttaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
25729228 |
ctattagttaaacaaattagaggcctaaatattctttgaggccaaaagcggctactttatttatggttttttttt--cttccagaaggatagatgttaat |
25729131 |
T |
 |
| Q |
195 |
agttactacttattagattaatatttattcttttcgtccgaatttaatttcatggcttttaatttcttatcatttatctcaaatcagttgaactatcaaa |
294 |
Q |
| |
|
|||||||||||| |||||||||||| | |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
25729130 |
agttactactta---gattaatatttacttttttcgtccgaatttaatttcatgacttttaatctcttatcatttatctcaaatcagttgaactatcgaa |
25729034 |
T |
 |
| Q |
295 |
catcgttatttatggtcttctttgaccggcctttg |
329 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25729033 |
catcgttatttatagtcttctttgaccggcctttg |
25728999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University