View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11616_low_6 (Length: 216)
Name: NF11616_low_6
Description: NF11616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11616_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 26375961 - 26375771
Alignment:
| Q |
16 |
gaagcacggataagaataggaatctgtacaat----attcattgaacaggaaacttcattctgttttattatgcaatactctttt--atttgcagtacag |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26375961 |
gaagcacggataagaatagaaatctgtacaattaatattcattgaacatgaaacttcattctgttttattatgcaatactcttttttatttgcagtacag |
26375862 |
T |
 |
| Q |
110 |
acacagaattccttactgatttttgaaatccaaatagggttaactgggctaattttaaataaacctaggtcatattcattcatggcataca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26375861 |
acacagaattccttactgatttttgaaatccaaatagggttaactgggctaattttaaacaaacctaggtcatattcattcatggcataca |
26375771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University