View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11617_high_18 (Length: 276)
Name: NF11617_high_18
Description: NF11617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11617_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 38633009 - 38633272
Alignment:
| Q |
1 |
acctggtgcttacaaagtaaagtacagtgggaaacaaaatcaaaggaaccagaaaatgagtaacagaacataaactgaaaagtaccgagtgtgattgtan |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38633009 |
acctggtgcttacaaagtaaagtacagtgggaaacaaaatcaaaggaaccagaaaatgagtaacagaacataaactgaaaagtaccgagtgtgattgtat |
38633108 |
T |
|
| Q |
101 |
nnnnnnnnn------gtgaatcggatatcctctatgcacaactgcgcatattaaatctctcgagtcagatagaaccactttccacaagagatttagcact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38633109 |
tttttttttttttttgtgaatcggatatcctctatgcacaactgcacatattaaatctctcgagtcagatagaaccactttccacaagagatttagcact |
38633208 |
T |
|
| Q |
195 |
attgcgctgcattttcagggttctattcaaaccttggaccttaagcatctcattcaagtgctct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38633209 |
attgcgctgcattttcagggttctattcgaaccttggaccttaagcatctcattcaagtgctct |
38633272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University