View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11617_high_19 (Length: 266)
Name: NF11617_high_19
Description: NF11617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11617_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 31806247 - 31806397
Alignment:
| Q |
1 |
catatacatttttgcctcgtcttttttctcgannnnnnnnnnaaaccttgtttatttccatccacttacgatgttcacgaacatccatttttctctaatt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31806247 |
catatacatttttgtctcgtcttttttctcgattttttttttaaaccttgtttatttccatccacttacaatgttcacgaacatccatttttctctaatt |
31806346 |
T |
 |
| Q |
101 |
gaaaaataagtggcattttaattagaatgcgtaattaattatatctaggtt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31806347 |
gaaaaataagtggcattttaattagaatgcgtgattaattatatctaggtt |
31806397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University