View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11617_high_22 (Length: 240)
Name: NF11617_high_22
Description: NF11617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11617_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 3951070 - 3950962
Alignment:
| Q |
1 |
caaaatcaatttctaagatgaagactacttattgcctataaacgcatttttagatcaaattttgtccaatgtgcgagttttgacagnnnnnnnagaaaaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3951070 |
caaaatcaatatctaagatgaagactacttattgcctataaacgcatttttagatcaaattttgtccaatgtgcgagttttgacagtttttttagaaaaa |
3950971 |
T |
 |
| Q |
101 |
tttgttcag |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
3950970 |
tttgttcag |
3950962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 170 - 224
Target Start/End: Complemental strand, 3950896 - 3950842
Alignment:
| Q |
170 |
atgataacataaccaaaaatttgaaaagtcaatgcaaaaatgttcacacaaaaat |
224 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3950896 |
atgataacataaccaaaaattagaaaagtcaatgcaaaaatgttcacacaaaaat |
3950842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University