View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11617_high_28 (Length: 210)

Name: NF11617_high_28
Description: NF11617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11617_high_28
NF11617_high_28
[»] chr5 (2 HSPs)
chr5 (66-113)||(14438102-14438149)
chr5 (113-159)||(14438013-14438058)


Alignment Details
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 66 - 113
Target Start/End: Complemental strand, 14438149 - 14438102
Alignment:
66 gtaagaaacccctatgtgaccattgtttcagtaaaacatggttggtct 113  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||    
14438149 gtaagaaacccctatgtgaccattgtttctgtaaaacatggttggtct 14438102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 113 - 159
Target Start/End: Complemental strand, 14438058 - 14438013
Alignment:
113 tttcagtcatcttctatttttatattacccacttgagaaatttattt 159  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||    
14438058 tttcagtcatcttctatttttata-tacccacttgagaaatttattt 14438013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University