View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11617_low_18 (Length: 276)

Name: NF11617_low_18
Description: NF11617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11617_low_18
NF11617_low_18
[»] chr7 (1 HSPs)
chr7 (1-258)||(38633009-38633272)


Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 38633009 - 38633272
Alignment:
1 acctggtgcttacaaagtaaagtacagtgggaaacaaaatcaaaggaaccagaaaatgagtaacagaacataaactgaaaagtaccgagtgtgattgtan 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
38633009 acctggtgcttacaaagtaaagtacagtgggaaacaaaatcaaaggaaccagaaaatgagtaacagaacataaactgaaaagtaccgagtgtgattgtat 38633108  T
101 nnnnnnnnn------gtgaatcggatatcctctatgcacaactgcgcatattaaatctctcgagtcagatagaaccactttccacaagagatttagcact 194  Q
                   |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38633109 tttttttttttttttgtgaatcggatatcctctatgcacaactgcacatattaaatctctcgagtcagatagaaccactttccacaagagatttagcact 38633208  T
195 attgcgctgcattttcagggttctattcaaaccttggaccttaagcatctcattcaagtgctct 258  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
38633209 attgcgctgcattttcagggttctattcgaaccttggaccttaagcatctcattcaagtgctct 38633272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University