View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11617_low_21 (Length: 242)
Name: NF11617_low_21
Description: NF11617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11617_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 39336268 - 39336029
Alignment:
| Q |
1 |
tggttgatggaaaacagttgccactgcttcacaaatggtaaatgtgtggggcttctagctagtttaaatgatcataaattaaattaaaatcaaatgctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39336268 |
tggttgatggaaaacagttgccactgcttcacaaatggtaaatgtgtggggcttctagctagtttaaatgatcataaattaaattaaaatcaaatgctat |
39336169 |
T |
|
| Q |
101 |
tgcagtgcaatatgcattatggaatgcaactaattaatcaaccgtggccttctcatccaagacatataagttttcattgcagattttgccccctagtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39336168 |
tgcagtgcaatatgcattatggaatgcaactaattaatcaaccgtggccttctcatccaagacatataagttttcattgcagattttgccccctagtgta |
39336069 |
T |
|
| Q |
201 |
ggacctaacctaacctagggaggcttgaagtccatctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39336068 |
ggacctaacctaacctagggaggcttgaagtccatctgtg |
39336029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University