View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11617_low_28 (Length: 210)
Name: NF11617_low_28
Description: NF11617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11617_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 66 - 113
Target Start/End: Complemental strand, 14438149 - 14438102
Alignment:
| Q |
66 |
gtaagaaacccctatgtgaccattgtttcagtaaaacatggttggtct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14438149 |
gtaagaaacccctatgtgaccattgtttctgtaaaacatggttggtct |
14438102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 113 - 159
Target Start/End: Complemental strand, 14438058 - 14438013
Alignment:
| Q |
113 |
tttcagtcatcttctatttttatattacccacttgagaaatttattt |
159 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14438058 |
tttcagtcatcttctatttttata-tacccacttgagaaatttattt |
14438013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University