View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11618_high_11 (Length: 322)
Name: NF11618_high_11
Description: NF11618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11618_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 34054716 - 34054417
Alignment:
| Q |
1 |
acctctaagattgagctctctgtgacagggagattaaagagggtgactctgttatagtggatgctgattctgatggaaatgttattgtgctcaatggtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34054716 |
acctctaagattgagctctctgtgacagggagattaaagagggtgactctgttatagtggatgctgattctgatggaaatgttattgtgctcaatggtag |
34054617 |
T |
 |
| Q |
101 |
tagtggtgctccagattcattgcctcttcctatgtaatatggctgcctttgaattccccccactttatttatttaagctctctaatcattagtgtcaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34054616 |
tagtggtgctccagattcattgcctcttcctgtgtaatatggctgcctttgaattccccccactttatttatttaagctctctaatcattagtgtcaaca |
34054517 |
T |
 |
| Q |
201 |
aatttctcaaacaaatgaaaattttgaatgcaaacaaccttttatgtgaaaacattttgtttannnnnnnnnctttcaaatactcatgttcctagtctat |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
34054516 |
aatttctcaaacaaatgaacattttgaatgcaaacaaccttttatgtgaaaacattttgttta-ttttttttctttcaaatactcgtgttcctagtctat |
34054418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 3e-39; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 30 - 124
Target Start/End: Original strand, 47383348 - 47383442
Alignment:
| Q |
30 |
gagattaaagagggtgactctgttatagtggatgctgattctgatggaaatgttattgtgctcaatggtagtagtggtgctccagattcattgcc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47383348 |
gagattaaagagggtgactctgttatagtggatgctgattccgatggaaatgtgattgtgctcaatggtagtagtggtgctccaaattcattgcc |
47383442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 30 - 124
Target Start/End: Original strand, 47818421 - 47818513
Alignment:
| Q |
30 |
gagattaaagagggtgactctgttatagtggatgctgattctgatggaaatgttattgtgctcaatggtagtagtggtgctccagattcattgcc |
124 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
47818421 |
gagattaaagagggcgactct--tatagtggatgctgattctgatggaaatgtgattgtgctcaatggtagtagtggtgctgcaaattcattgcc |
47818513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 204 - 258
Target Start/End: Original strand, 47383829 - 47383883
Alignment:
| Q |
204 |
ttctcaaacaaatgaaaattttgaatgcaaacaaccttttatgtgaaaacatttt |
258 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
47383829 |
ttctcaaacaaatgaacattttcaatgcaaacaagcttttatgtgaaaacatttt |
47383883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 99
Target Start/End: Original strand, 45116297 - 45116366
Alignment:
| Q |
30 |
gagattaaagagggtgactctgttatagtggatgctgattctgatggaaatgttattgtgctcaatggta |
99 |
Q |
| |
|
||||| |||||||||||||| || |||||||||| |||||| || || ||||| ||||| |||||||||| |
|
|
| T |
45116297 |
gagatcaaagagggtgactccgtaatagtggatgttgattccgagggtaatgtgattgttctcaatggta |
45116366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 27 - 124
Target Start/End: Original strand, 40246059 - 40246156
Alignment:
| Q |
27 |
agggagattaaagagggtgactctgttatagtggatgctgattctgatggaaatgttattgtgctcaatggtagtagtggtgctccagattcattgcc |
124 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
40246059 |
agggagattaaagagggcgactctgttatagtggatgctgattctgatggaaacgtgattgtactcaacggtagtactggtgctccagattcattgcc |
40246156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University