View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11618_high_16 (Length: 268)
Name: NF11618_high_16
Description: NF11618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11618_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 37598088 - 37597845
Alignment:
| Q |
1 |
tgtagtactatactgattacttatcaatagccaataatgtttggttgaaatgaaaatacaactgtgcttgacgctaaaaataggagctccaagaagcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37598088 |
tgtagtactatactgattacttatcaatagccaataatgtttggttgaaatgaaaatacaactgtgcttgacgctaaaaataggagcttcaagaagcaat |
37597989 |
T |
 |
| Q |
101 |
atgtgaaattttttatttattgtttagatacatgaggtgctttgtagaaacactgtttgttttcttctgttgttactcggagtgattgtcataattggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597988 |
atgtgaaattttttatttattgtttagatacatgaggtgctttgtagaaacactgtttgttttcttctgttgttactcggagtgattgtcataattggta |
37597889 |
T |
 |
| Q |
201 |
tatgacactaacttatattgaaacaatacatctaattttgcttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37597888 |
tatgacactaacttatattgaaacaatacatctaattttgcttc |
37597845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University