View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11618_high_17 (Length: 252)
Name: NF11618_high_17
Description: NF11618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11618_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 41145101 - 41144871
Alignment:
| Q |
19 |
gtgatgtataatgtactatgcttaaatttttgtgaaaatttctgctcacattattattatattcaatatgatgaattacttataagtaatacaacaaatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41145101 |
gtgatgtataatgtactatgcttaaatttttgtgaaaatttctgctcacattattataatattcaatatcatgaattacttataagtaatacaacaaatt |
41145002 |
T |
 |
| Q |
119 |
aaaatttcctgtctccttggtgctaacacatattttacttgtcctgannnnnnnnctttcagatatggattatggtagtggtgctatgctctttttgttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41145001 |
aaaatttcctgtctccttggtgctaacacatactttacttgtcctgattttttttctttcagatatggattatggtagtggtgctatgctctttttgttg |
41144902 |
T |
 |
| Q |
219 |
acatgcattgtcacatacttttttggttcat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41144901 |
acatgcattgtcacatacttttttggttcat |
41144871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 41120497 - 41120456
Alignment:
| Q |
207 |
ctctttttgttgacatgcattgtcacatacttttttggttca |
248 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
41120497 |
ctctttttgctgacatgcattgtcacgtacttttttggttca |
41120456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 195 - 248
Target Start/End: Original strand, 41033691 - 41033744
Alignment:
| Q |
195 |
agtggtgctatgctctttttgttgacatgcattgtcacatacttttttggttca |
248 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||| |||||||||||| || ||||| |
|
|
| T |
41033691 |
agtggtgcaatgctccttttgatgacatgcatggtcacatactttatttgttca |
41033744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University