View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11618_high_22 (Length: 201)
Name: NF11618_high_22
Description: NF11618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11618_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 43119449 - 43119543
Alignment:
| Q |
19 |
caatatgtaaaattcagcctattggaatatgactcatagtcataaatctattttttctaggtacaacaactatcaaattgttttcactgggcgac |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
43119449 |
caatatgtaaaattcaatctattggaatatgactcatagtcataaatctattttttctaggtacaacaactttcaagttgttttcactgggcgac |
43119543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 6783912 - 6783829
Alignment:
| Q |
23 |
atgtaaaattcagcctattggaatatgactcatagtcataaatctatttttt-ctaggtacaacaactatcaaattgttttcac |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| || |||||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
6783912 |
atgtaaaattcaatctattggaatatgacccatggttgtaaatctatttttttctaggtacaacaactttcaagttgttttcac |
6783829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University