View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11618_low_21 (Length: 219)
Name: NF11618_low_21
Description: NF11618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11618_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 9439850 - 9440036
Alignment:
| Q |
16 |
tgaatatatatgactttgacaaagatattagttatggttgtggttatattgcttaaattgggtaaagtaatgtataataaattatgtcgtggtgtgcttt |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9439850 |
tgaatatatataactttgacaaagatattatgtatggttgtggttatattgcttaaattgggtaaagtaatgtataataaaatatgtcgtggtgtgcttt |
9439949 |
T |
 |
| Q |
116 |
tctaaatatttaattttcgagttcttttgatgtaaatttatgtgagctaattcataaataggctctctcaacctctctatcacatat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439950 |
tctaaatatttaattttcgagttcttttgatgtaaatttatgtgagctaattcataaataggctctctcaacctctctatcacatat |
9440036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University